Sequence ID | >WENV170722238 |
Genome ID | LSQX01222309 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1668 |
End posion on genome | 1583 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
gaagttctat |
tRNA gene sequence |
GTTGAGGTAGCCAAGCCTGGTATGGCGCAGGTTTGCTAAACCTGTGTCCCCCTGGGACTC |
Downstream region at tRNA end position |
tcaccgacaa |
Secondary structure (Cloverleaf model) | >WENV170722238 Ser GCT t GCtt tcaccgacaa G - C T + G T - A G - C A - T G - C G - C T A T C T C C C A C G A A + | | | A C A C C G A G G G G C T | | | | T T G T G G C G T A G TGTCCCCCTGGGACTC C - G A - T G - C G - C T - A T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |