Sequence ID | >WENV170722253 |
Genome ID | LSQX01222614 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 13536 |
End posion on genome | 13610 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
gcgttcatac |
tRNA gene sequence |
TGGGGTGTAGCCAAGACGGCAAGGCGGCGGACTTTGGATCCGTGATCGCTGGTTCGAATC |
Downstream region at tRNA end position |
tttaagactc |
Secondary structure (Cloverleaf model) | >WENV170722253 Gln TTG c GCCA tttaagactc T - A G - C G - C G - C G - C T - A G - C T A T C G A C C A A G A A | | | | | G C A C C G G C T G G C G | | | T T G A G G C C A G GATC G + T C - G G - C G - C A - T C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |