Sequence ID | >WENV170722265 |
Genome ID | LSQX01223007 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3427 |
End posion on genome | 3354 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tttcaaatac |
tRNA gene sequence |
GGCATCGTGGCCGAGTGGCTAGGCAGAGGTCTGCAAAACCTTCTACAGCGGTTCGAATCC |
Downstream region at tRNA end position |
aaaaccttca |
Secondary structure (Cloverleaf model) | >WENV170722265 Cys GCA c TCCA aaaaccttca G - C G - C C - G A - T T - A C - G G - C T A T T C G C C A G A G | | | | | G T G C C G A G C G G C G | | | T T G A G G C C T A CTAC G + T A - T G - C G - C T - A C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |