Sequence ID | >WENV170722517 |
Genome ID | LSQX01232629 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2317 |
End posion on genome | 2388 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tccactttgt |
tRNA gene sequence |
GCCAAGGTGGCGGAGCGGCTACGCAATCGCCTGCAGAGCGATACCATTCCGGTTCGAATC |
Downstream region at tRNA end position |
taaacacttt |
Secondary structure (Cloverleaf model) | >WENV170722517 Cys GCA t Tttt taaacacttt G - C C - G C - G A - T A - T G - C G - C T A T A G G C C A G A G | | | | | G C G G C G T C C G G C G | | | T T G A C G C C T A ACCAT A - T T - A C - G G - C C - G C A T G G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |