Sequence ID | >WENV170722558 |
Genome ID | LSQX01233714 |
Search identical group | |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1522 |
End posion on genome | 1595 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
gcacagccgT |
tRNA gene sequence |
GCGCCGATAGTGTAGTGGTTATCACTAGGCGTTGCCAACGCCTAAACCCGGGTTCGAGTC |
Downstream region at tRNA end position |
gatactcaag |
Secondary structure (Cloverleaf model) | >WENV170722558 Gly GCC T ATaa gatactcaag G - C C - G G - C C - G C - G G - C A C T G T G G C C C A T G A A | | | | | G G T G T G C C G G G C G | | | T T T T C A C T A T AAAC A - T G - C G - C C - G G - C T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |