Sequence ID | >WENV170722703 |
Genome ID | LSQX01240207 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 84181 |
End posion on genome | 84109 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gggccatgtc |
tRNA gene sequence |
GCGGGAGTAACTCAGTGGTAGAGTGCTAGCTTCCCAAGCTGGACGTCGCGGGTTCGAATC |
Downstream region at tRNA end position |
aacgtaaacc |
Secondary structure (Cloverleaf model) | >WENV170722703 Gly CCC c TCtt aacgtaaacc G - C C - G G - C G - C G - C A - T G - C T A T T G C C C A G A A + | | | | G T C T C A G C G G G C G | | | | T T G G A G T T A G ACGTC C - G T + G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |