Sequence ID | >WENV170722890 |
Genome ID | LSQX01247460 |
Search identical group | |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1276 |
End posion on genome | 1352 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
tccggatctt |
tRNA gene sequence |
GTGCCTGTAGCTCAGCTGGATAGAGTGTCAGCCTCCGGAGCTGAAGGTCTCGGGTTCGAA |
Downstream region at tRNA end position |
tttgaataat |
Secondary structure (Cloverleaf model) | >WENV170722890 Arg CCG t GCCA tttgaataat G - C T - A G - C C - G C - G T - A G - C T A T A G C C C A C G A A | | | | | G T C T C G T C G G G C G | | | + T T G G A G T A T A G AGGTC T - A C - G A - T G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |