Sequence ID | >WENV170722891 |
Genome ID | LSQX01247460 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 689 |
End posion on genome | 597 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgatgcacgc |
tRNA gene sequence |
GGAGAGGTGGCTGAGTGGTCGAAGGCGCTCGCCTGGAAAGTGAGTGAACGGCTTATCCCC |
Downstream region at tRNA end position |
tttttgtatc |
Secondary structure (Cloverleaf model) | >WENV170722891 Ser GGA c GCCA tttttgtatc G - C G - C A - T G - C A - T G - C G - C T A T T T C C C A T G A G | | | | | A G G T C G A A G G G C G + | | T T T A G G C C G A G TGAACGGCTTATCCCCGTTCC C - G T - A C - G G + T C - G C A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |