Sequence ID | >WENV170722965 |
Genome ID | LSQX01249798 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2178 |
End posion on genome | 2261 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atttatactt |
tRNA gene sequence |
GCGGACGTGGCGGAATTGGGAGACGCGCTAGACTTAGGATCTAGTGTCTACGACGTGGGG |
Downstream region at tRNA end position |
caagggtttg |
Secondary structure (Cloverleaf model) | >WENV170722965 Leu TAG t ACCA caagggtttg G - C C - G G - C G - C A - T C - G G - C T G T T T C C C A T A A G + + | | | A T G G C G G G G G G C G | | | T T G A C G C G A G G TGTCTACGACGT C - G T - A A - T G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |