Sequence ID | >WENV170722969 |
Genome ID | LSQX01249920 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 2886 |
End posion on genome | 2811 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
cagccatcta |
tRNA gene sequence |
GCCCAGATAGCTCAGTCGGTAGAGCAGAGGACTGAAAATCCTCGTGTCGGCGGTTCGATT |
Downstream region at tRNA end position |
taaataataa |
Secondary structure (Cloverleaf model) | >WENV170722969 Phe GAA a ACCA taaataataa G - C C - G C - G C T A - T G - C A C T T T C T G C C A T G A A | + | | | G C C T C G G G C G G C G | | | | T T G G A G C T A A GTGTC G - C A - T G - C G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |