Sequence ID | >WENV170723029 |
Genome ID | LSQX01252460 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 91 |
End posion on genome | 1 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gttctttcgc |
tRNA gene sequence |
GGTGGCGTGTCCGAGCGGCCGAAGGTGCTCGCCTCGAAAGCGAGTGTTGGGTAACCCCCA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170723029 Ser CGA c GCCA nnnnnnnnnn G - C G - C T - A G - C G - C C - G G - C T A T C T C C C A C G A G | | | | | A G G C C T G A G G G C G | | T T C A G G T C G A G TGTTGGGTAACCCCCAACC C - G T - A C - G G - C C - G C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |