Sequence ID | >WENV170723122 |
Genome ID | LSQX01255570 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 141 |
End posion on genome | 229 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
caataaaatt |
tRNA gene sequence |
GCCGAAGTGGCGGAATTGGCAGACGCACAGGACTTAAAATCCTGCGGTCCTTCAAGACCG |
Downstream region at tRNA end position |
gattatcgcg |
Secondary structure (Cloverleaf model) | >WENV170723122 Leu TAA t ACCA gattatcgcg G - C C - G C - G G - C A - T A - T G - C T G T T G G C C A T A A G | | | | | G T G G C G A C C G G C G | | | T T G A C G C C A G A CGGTCCTTCAAGACCGT C - G A - T G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |