| Sequence ID | >WENV170723226 |
| Genome ID | LSQX01259727 |
| Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
| Species | |
| Start position on genome | 75 |
| End posion on genome | 1 |
| Amino Acid | Arg |
| Anticodon | CCG |
| Upstream region at tRNA start position |
ttggccccat |
| tRNA gene sequence |
GCGCCTGTAGCTCAATTGGATAGAGTGTCGGCCTCCGAAGCCGAAGGTTGTGGGTTCGAT |
| Downstream region at tRNA end position |
nnnnnnnnnn |
| Secondary structure (Cloverleaf model) | >WENV170723226 Arg CCG
t ACnn nnnnnnnnnn
G - C
C - G
G - C
C - G
C - G
T - A
G - C C T
T C G C C C A
T A A A | + | | | G
T C T C G G T G G G C
G | | | + T T
G G A G T
A T A G AGGTT
T - A
C - G
G - C
G - C
C - G
C A
T A
C C G
|
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] |
| Comment | |
| --- | |
| Input Comment |