Sequence ID | >WENV170723380 |
Genome ID | LSQX01266485 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 40143 |
End posion on genome | 40217 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
taatcattgt |
tRNA gene sequence |
GCTCATATGGCTCAGAGGTAGAGCACTTCCTTGGTAAGGAAGAGGTCGTGGGTTCAAGTC |
Downstream region at tRNA end position |
ccttaattat |
Secondary structure (Cloverleaf model) | >WENV170723380 Thr GGT t TCCA ccttaattat G - C C - G T - A C - G A - T T - A A - T T G T C A C C C A G A G | | | | | A A C T C G G T G G G C G | | | | T T G G A G C T A A AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |