Sequence ID | >WENV170723501 |
Genome ID | LSQX01271170 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 13678 |
End posion on genome | 13751 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
aatttttcgc |
tRNA gene sequence |
TGCGGGATTGTGTAACGGTAGCACCCATGACTCTGGATCATGTTGTCCAGGTTCGAATCC |
Downstream region at tRNA end position |
tatttatggc |
Secondary structure (Cloverleaf model) | >WENV170723501 Gln CTG c GCCA tatttatggc T - A G - C C - G G - C G - C G - C A - T T A T G G T C C A A A T | | | | | G C T G T G C C A G G C G + | | | T T G G C A C T A C TTGT C - G A - T T - A G - C A - T C A T G C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |