Sequence ID | >WENV170723691 |
Genome ID | LSQX01278313 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 10544 |
End posion on genome | 10617 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
acacaggcgt |
tRNA gene sequence |
GCGGGTGTAGTTCAATGGTAGAACATCAGCCTTCCAAGCTGATTGCGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tttatttgaa |
Secondary structure (Cloverleaf model) | >WENV170723691 Gly TCC t TCCA tttatttgaa G - C C - G G - C G - C G - C T - A G - C T T T T A C C C A A A A + | | | | G T C T T G G T G G G C G | | | | T T G G A A C T A A TTGC T - A C - G A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |