Sequence ID | >WENV170723700 |
Genome ID | LSQX01278600 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1420 |
End posion on genome | 1330 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
aaattcatac |
tRNA gene sequence |
GGAGAGATGGTCGAGTTGGTTTAAGGCACCGGTCTTGAAAACCGGCGTAGGGGTGACCCT |
Downstream region at tRNA end position |
cacggagaag |
Secondary structure (Cloverleaf model) | >WENV170723700 Ser TGA c GCCA cacggagaag G - C G - C A - T G - C A - T G - C A - T T A T A T C C C A T T G A G | | | | | G G G C T G T A G G G C G | + | T T T A G G C T T A A CGTAGGGGTGACCCTACC C - G C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |