Sequence ID | >WENV170723781 |
Genome ID | LSQX01281351 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 6674 |
End posion on genome | 6592 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
aggtacaggc |
tRNA gene sequence |
GCGAGGGTAGCCAAGCGGTCAACGGCGGTCGACTCAAGATCGACTCTCAAAGGAGTTCGC |
Downstream region at tRNA end position |
ctggtccggg |
Secondary structure (Cloverleaf model) | >WENV170723781 Leu CAA c Attt ctggtccggg G - C C - G G - C A - T G - C G - C G - C T A T C T C C C A C G A A | | | | G G A C C G G C G G G C G | | | T T T C G G C C A A G TCTCAAAGGAGTTC G - C T - A C - G G - C A - T C A T G C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |