Sequence ID | >WENV170723806 |
Genome ID | LSQX01282197 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 18963 |
End posion on genome | 18889 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
tgaccagcgc |
tRNA gene sequence |
GGCCCATTGGTCAAGCGGTTAAGACACCGCCCTTTCACGGCGGTAACAGGGGTTCGAGTC |
Downstream region at tRNA end position |
ctgaagcagg |
Secondary structure (Cloverleaf model) | >WENV170723806 Glu TTC c ACCA ctgaagcagg G - C G + T C - G C - G C - G A - T T - A T G T T C C C C A C G A G | | | | | G G A C T G A G G G G C G | | | T T T A G A C T A A TAAC C - G C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |