Sequence ID | >WENV170723822 |
Genome ID | LSQX01282691 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3057 |
End posion on genome | 3145 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ccaccaagtt |
tRNA gene sequence |
GGAGGAGTACCCAAGCGGCTGAAGGGACTGGTCTTGAAAACCAGCAGACGTGAAAGCGTG |
Downstream region at tRNA end position |
ttatttaaat |
Secondary structure (Cloverleaf model) | >WENV170723822 Ser TGA t GCCA ttatttaaat G - C G - C A - T G - C G - C A - T G - C T A T C C C T C A C G A A | | | | | G G A C C C G G G A G C G | | | T T C A G G G T G A A CAGACGTGAAAGCGTGC C - G T - A G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |