Sequence ID | >WENV170723996 |
Genome ID | LSQX01288633 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 6333 |
End posion on genome | 6245 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
ggtacgccaT |
tRNA gene sequence |
GGAGAGATGCCTGAGCGGTCGAAAGGACACGCTTGGAGAGCGTGCGTATGAGAAATCGTA |
Downstream region at tRNA end position |
ttatatttat |
Secondary structure (Cloverleaf model) | >WENV170723996 Ser GGA T GTag ttatatttat G - C G - C A - T G - C A - T G - C A - T T A T C A C C C A C G A G | | | | | G G G T C C G T G G G C G | | | T T T A A G G C G A A CGTATGAGAAATCGTACC C - G A - T C - G G - C C - G T A T G G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |