Sequence ID | >WENV170724071 |
Genome ID | LSQX01292163 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 34263 |
End posion on genome | 34167 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
cctgcgctaa |
tRNA gene sequence |
GCCGTCGTAGCTCAGCTGGTAGAGCGTGTGACTGTTAATCCCTTTACCGGGAACGGTCAT |
Downstream region at tRNA end position |
tccttttcct |
Secondary structure (Cloverleaf model) | >WENV170724071 Asn GTT a GCCA tccttttcct G - C C - G C - G G - C T - A C - G G - C C G T T T G C C A C G A A | | | | | G T C T C G A A C G G C G | | | | T T G G A G C T A G TTACCGGGAACGGTCATCACAAGGTC T T G - C T C G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |