Sequence ID | >WENV170724212 |
Genome ID | LSQX01297327 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 45671 |
End posion on genome | 45597 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
gaaatgaaaa |
tRNA gene sequence |
GCCGACGTAGCTCAGGGGTAGAGCGTTTCCTTGGTAAGGAAGAGGTCATGGGTTCAATTC |
Downstream region at tRNA end position |
acggaaaaat |
Secondary structure (Cloverleaf model) | >WENV170724212 Thr GGT a TCAA acggaaaaat G - C C - G C - G G - C A - T C - G G - C T T T T A C C C A G A A | | | | | A G C T C G A T G G G C G | | | | T T G G A G C T A G AGGTC T + G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |