Sequence ID | >WENV170724274 |
Genome ID | LSQX01299107 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 36964 |
End posion on genome | 36890 |
Amino Acid | Gly |
Anticodon | GCC |
Upstream region at tRNA start position |
aagatcgtga |
tRNA gene sequence |
GCGGGCGTAACTCAGCGGTAGAGTGCTACCTTGCCAAGGTAGACGTCGACGGTTCAAATC |
Downstream region at tRNA end position |
ttcaattttg |
Secondary structure (Cloverleaf model) | >WENV170724274 Gly GCC a TCCA ttcaattttg G - C C - G G - C G - C G - C C - G G - C T A T T T G C C A G A A + | | | | A C C T C A G A C G G C G | | | | T T G G A G T T A G ACGTC C - G T - A A - T C - G C - G T A T A G C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |