Sequence ID | >WENV170724343 |
Genome ID | LSQX01301653 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 40002 |
End posion on genome | 40076 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
ccgtgggcgc |
tRNA gene sequence |
TGGGGCGTGGCCAAGCGGTAAGGCGCGGGACTTTGGATCCCGTATTCGTAGGTTCGAATC |
Downstream region at tRNA end position |
tcaaggcggc |
Secondary structure (Cloverleaf model) | >WENV170724343 Gln TTG c GCCA tcaaggcggc T - A G - C G - C G - C G - C C - G G - C T A T C A T C C A G A G | | | | | G C A C C G G T A G G C G | | | T T G A G G C T A G TATTC C - G G - C G - C G - C A - T C A T G T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |