Sequence ID | >WENV170724366 |
Genome ID | LSQX01302579 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 20457 |
End posion on genome | 20529 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttaacaatga |
tRNA gene sequence |
AGGTCTGTGGTGTAGAGGATATCACTGGAGCCTCCGGAGCTCCGAACCTGGGTTCGATTC |
Downstream region at tRNA end position |
cttaactcca |
Secondary structure (Cloverleaf model) | >WENV170724366 Arg CCG a GCtt cttaactcca A - T G - C G - C T - A C - G T - A G - C T T T G A C C C A A G A G | | | | | G G T G T G C T G G G C G | | | T T A T C A C T A T GAAC G - C G - C A - T G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |