Sequence ID | >WENV170724386 |
Genome ID | LSQX01303608 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 3432 |
End posion on genome | 3505 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
acagcaattt |
tRNA gene sequence |
GGTACCTTAGCCAAGTGGTAAGGCAATAGACTGCAACTCTGTGATCGTCGGTTCGAATCC |
Downstream region at tRNA end position |
ctaatgggga |
Secondary structure (Cloverleaf model) | >WENV170724386 Cys GCA t TCCA ctaatgggga G - C G - C T - A A - T C - G C - G T - A T A T T A G C C A G A A + | | | | G T A C C G G T C G G C G | | | T T G A G G C T A A GATC A - T T + G A - T G - C A - T C C T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |