Sequence ID | >WENV170724469 |
Genome ID | LSQX01306584 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 5715 |
End posion on genome | 5627 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
atatctataT |
tRNA gene sequence |
GCCGAGGTGGTGAAATTGGCAGACACGCTACCTTGAGGTGGTAGTGGGACTTATACTCTC |
Downstream region at tRNA end position |
ttactttagt |
Secondary structure (Cloverleaf model) | >WENV170724469 Leu GAG T ATtt ttactttagt G - C C - G C - G G - C A - T G - C G - C T C T T G T C C A T A A G + | | | | A T A G T G G C A G G C G | | | T T G A C A C C A G G TGGGACTTATACTCTCGT C - G T - A A - T C - G C - G T T T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |