Sequence ID | >WENV170724534 |
Genome ID | LSQX01308862 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1453 |
End posion on genome | 1367 |
Amino Acid | Leu |
Anticodon | CAG |
Upstream region at tRNA start position |
gccgcgcagt |
tRNA gene sequence |
GCCGAAGTGGCGGAATTGGTAGACGCGCTAGGTTCAGGGTCTAGTTGGGGTTCCCCAGTG |
Downstream region at tRNA end position |
ttttaagaga |
Secondary structure (Cloverleaf model) | >WENV170724534 Leu CAG t ACCA ttttaagaga G - C C - G C - G G - C A - T A - T G - C T G T T C T T C A T A A G + | | | | G T G G C G G G A A G C G | | | T T G A C G C T A G G TTGGGGTTCCCCAGT C - G T - A A - T G - C G + T T G T G C A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |