Sequence ID | >WENV170724998 |
Genome ID | LSQX01327275 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 9159 |
End posion on genome | 9244 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gctctggagt |
tRNA gene sequence |
GCCGAAGTGGTGGAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCCCACGGTCGTGC |
Downstream region at tRNA end position |
gctcgcagca |
Secondary structure (Cloverleaf model) | >WENV170724998 Leu GAG t ACCA gctcgcagca G - C C - G C - G G - C A - T A - T G - C T G T C G C T C A T A A G | | | | | G T G G T G G C G A G C G | | | T T G A C A C T A G G TGGCCCACGGTCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |