Sequence ID | >WENV170725020 |
Genome ID | LSQX01327958 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 590 |
End posion on genome | 505 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
cggctcgttc |
tRNA gene sequence |
GGAGGGATACCCAAGCGGCCAACGGGGGCAGACTGTAAATCTGCTGGCTTACGCCTTCGG |
Downstream region at tRNA end position |
atcgcccagg |
Secondary structure (Cloverleaf model) | >WENV170725020 Tyr GTA c ACCA atcgcccagg G - C G - C A - T G - C G - C G - C A - T T A T C C A C C A C G A A | | | | | G G A C C C G G T G G C G | | | T T C C G G G C A A G TGGCTTACGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |