Sequence ID | >WENV170725599 |
Genome ID | LSQX01348891 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 20278 |
End posion on genome | 20352 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
ccgagtcgtt |
tRNA gene sequence |
GGGTGGTTAGTTCAGGGGGAGAACGCTTCCTTGACGCGGAAGAGGTCAGAGGTTCAATTC |
Downstream region at tRNA end position |
ttgagaatac |
Secondary structure (Cloverleaf model) | >WENV170725599 Val GAC t ACCA ttgagaatac G - C G - C G - C T - A G - C G - C T - A T T T T C T C C A G A A | | | | | A G C T T G A G A G G C G | | | | T T G G A A C G A G AGGTC C - G T - A T - A C - G C - G T C T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |