Sequence ID | >WENV170725623 |
Genome ID | LSQX01349776 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 1003 |
End posion on genome | 1086 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
attagggtag |
tRNA gene sequence |
GCGAGGGTAGCCAAGCCAGGCCAACGGCGCCAGACTTAAGATCTGGTCTTCAGTAGTTCA |
Downstream region at tRNA end position |
ttatgaaacc |
Secondary structure (Cloverleaf model) | >WENV170725623 Leu TAA g Attt ttatgaaacc G - C C - G G - C A - T G - C G - C G - C T A T T T C C C A C C G A A | | | | G A A C C G A T G G G C G | | | T T G C G G C C C A A G TCTTCAGTAGTTC C - G C - G A - T G - C A - T C A T G T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |