Sequence ID | >WENV170725831 |
Genome ID | LSQX01358336 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 375 |
End posion on genome | 459 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
gcaaggaagt |
tRNA gene sequence |
GGTGGGATGGCCGAGTGGTCAAAGGCAGCAGACTGTAAATCTGCCGACACCGTCTACGAA |
Downstream region at tRNA end position |
ttttatatat |
Secondary structure (Cloverleaf model) | >WENV170725831 Tyr GTA t ACCA ttttatatat G - C G - C T - A G - C G - C G - C A - T T A T C T T C C A T G A G | | | | | G G G C C G G A A G G C G | | | T T T A G G C C A A A CGACACCGTCTAC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |