Sequence ID | >WENV170725866 |
Genome ID | LSQX01359309 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 78 |
End posion on genome | 164 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
ctcgcgccat |
tRNA gene sequence |
GCCTCGGTGGCGGAATTGGTAGACGCAGCGGATTCAAAATCCGCCGTTGGCAACAACGTG |
Downstream region at tRNA end position |
tgaaaaacaa |
Secondary structure (Cloverleaf model) | >WENV170725866 Leu CAA t ACCA tgaaaaacaa G - C C - G C - G T - A C - G G - C G - C T T T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G A CGTTGGCAACAACGT G - C C - G G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |