Sequence ID | >WENV170725886 |
Genome ID | LSQX01359576 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 10482 |
End posion on genome | 10553 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
taaggcaatt |
tRNA gene sequence |
GCCGCTGTGGCTTAGTGGTATAGCGGCTGATTCGTAATCAGCAGGTCGGGGGTTCAAGTC |
Downstream region at tRNA end position |
ttccttttca |
Secondary structure (Cloverleaf model) | >WENV170725886 Thr CGT t Ttat ttccttttca G - C C - G C - G G - C C - G T - A G - C T G T C C C C C A G A G | | | | | A T T T C G G G G G G C G | | | T T G T A G C T A G AGGTC G - C C - G T - A G - C A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |