Sequence ID | >WENV170726130 |
Genome ID | LSQX01368545 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 173264 |
End posion on genome | 173190 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
gttataatga |
tRNA gene sequence |
GCGGGAGTAATTCAGCGGTAGAATGCCAGCTTCCCAAGCTGGACGTCGCCGGTTCGATCC |
Downstream region at tRNA end position |
gaccaacctc |
Secondary structure (Cloverleaf model) | >WENV170726130 Gly CCC a TCCA gaccaacctc G - C C - G G - C G - C G - C A - T G - C C T T T G G C C A G A A + | | | | G C C T T A G C C G G C G | | | | T T G G A A T T A G ACGTC C - G C - G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |