Sequence ID | >WENV170726146 |
Genome ID | LSQX01368963 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 158679 |
End posion on genome | 158765 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tctgcgccat |
tRNA gene sequence |
GCCTCGGTGGCGGAATTGGTAGACGCAGTGGATTCAAAATCCACCGTTGGTAACAACGTG |
Downstream region at tRNA end position |
atttctttag |
Secondary structure (Cloverleaf model) | >WENV170726146 Leu CAA t ACCA atttctttag G - C C - G C - G T - A C - G G - C G - C T T T C C C T C A T A A G | | | | | G T G G C G G G G A G C G | | | T T G A C G C T A G A CGTTGGTAACAACGT G - C T - A G - C G - C A - T T A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |