Sequence ID | >WENV170726281 |
Genome ID | LSQX01373847 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 8007 |
End posion on genome | 7933 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gtaatgacgt |
tRNA gene sequence |
TCCGCGATAGCTCAATGGTGGAGCACTCGGCTGTTAACCGATAGGTTGGAGGTTCGAGTC |
Downstream region at tRNA end position |
tttttttatt |
Secondary structure (Cloverleaf model) | >WENV170726281 Asn GTT t GCCA tttttttatt T - A C - G C - G G - C C - G G - C A - T T G T T C T C C A A A A + | | | | G T C T C G G G A G G C G | | | | T T G G A G C T G A AGGTT C T T - A C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |