Sequence ID | >WENV170726463 |
Genome ID | LSQX01381397 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 20712 |
End posion on genome | 20796 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
ttaattggat |
tRNA gene sequence |
GGGGAGATACTCAAGCGGCCAACGAGGGCAGACTGTAAATCTGCTGACTATGTCTTCGCA |
Downstream region at tRNA end position |
gtcttcattt |
Secondary structure (Cloverleaf model) | >WENV170726463 Tyr GTA t ACAA gtcttcattt G - C G - C G - C G - C A - T G - C A - T T A T C G T C C A C G A A | | | | | G G A C T C G C A G G C G | | | T T C C G A G C A A G TGACTATGTCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |