Sequence ID | >WENV170726481 |
Genome ID | LSQX01381975 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 11234 |
End posion on genome | 11159 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
caaaacagac |
tRNA gene sequence |
ACGGGTGTAGCTCAGTTGGCAGAGCACTGGTCTCCAAAACCAGGTGTCGGGAGTTCGAGT |
Downstream region at tRNA end position |
agaaaagaca |
Secondary structure (Cloverleaf model) | >WENV170726481 Trp CCA c GCAA agaaaagaca A - T C - G G - C G - C G - C T T G - C T G T C T C T C A T G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C C A A GTGTC C - G T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |