Sequence ID | >WENV170726768 |
Genome ID | LSQX01393911 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 18374 |
End posion on genome | 18460 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
gctggtcgaa |
tRNA gene sequence |
GCAGGGGTAGCCAAGCTTGGCCAACGGCGCAAGGTTGAGGGCCTTGTCCTTAGTGGTCCG |
Downstream region at tRNA end position |
ccatcccctt |
Secondary structure (Cloverleaf model) | >WENV170726768 Leu GAG a ACCA ccatcccctt G - C C - G A - T G - C G - C G - C G - C T A T T T C C C A T C G A A + | | | | A T A C C G G A G G G C G | | | T T G C G G C C C A A G TCCTTAGTGGTCC C - G A - T A - T G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |