Sequence ID | >WENV170726769 |
Genome ID | LSQX01393911 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 93541 |
End posion on genome | 93455 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
atctggcaga |
tRNA gene sequence |
GCAGGGGTAGCCAAGCTTGGCCAACGGCGCAGGACTTAGGATCCTGTCCTTAGTGGTCCG |
Downstream region at tRNA end position |
ctgccatttc |
Secondary structure (Cloverleaf model) | >WENV170726769 Leu TAG a ACCA ctgccatttc G - C C - G A - T G - C G - C G - C G - C T A T C A C G C A T C G A A | | | | | A T A C C G G T G C G C G | | | T T G C G G C C C A A G TCCTTAGTGGTCC C - G A - T G - C G - C A - T C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |