Sequence ID | >WENV170726874 |
Genome ID | LSQX01396864 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 51069 |
End posion on genome | 50983 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tgtggcccaa |
tRNA gene sequence |
GCGGAGGTGGCCCAGCCTGGCAAGGCGCAGGATTGCTAATCCTGTGTCCGCAAGGACTCG |
Downstream region at tRNA end position |
ctttccaatc |
Secondary structure (Cloverleaf model) | >WENV170726874 Ser GCT a GCCA ctttccaatc G - C C - G G - C G - C A - T G - C G - C T A T C C C C C A C G A G | | | | | A C C C C G G G G G G C T | | | T T G A G G C G C A G TGTCCGCAAGGACTC C - G A - T G - C G - C A - T T A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |