Sequence ID | >WENV170726884 |
Genome ID | LSQX01397153 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 4417 |
End posion on genome | 4510 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
gggttaatgc |
tRNA gene sequence |
GGAGAGATACCGAAGTGGTCGTAACGGGATCGACTCGAAATCGATTTGGGGGCCAAAAGC |
Downstream region at tRNA end position |
ctgtcatgtt |
Secondary structure (Cloverleaf model) | >WENV170726884 Ser CGA c GCCA ctgtcatgtt G - C G - C A - T G - C A - T G - C A - T T A T C C C C C A G T G A A | | | | | G G A G C C G G G G G C T | | | T T C A C G G G T A G TTGGGGGCCAAAAGCTCCCAC A - T T - A C - G G - C A - T C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |