Sequence ID | >WENV170726994 |
Genome ID | LSQX01400804 |
Phylum/Class | [LSQX] anaerobic digester metagenome; 4 biogas reactors fed with cattle manure at either 37C or 55C with and without the addition |
Species | |
Start position on genome | 112991 |
End posion on genome | 113066 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
gataaaagaa |
tRNA gene sequence |
GGGCCCTTAGCTCAGCTGGTAGAGCAACTGACTCTTAATCAGTAGGTTGTCGGTTCGATC |
Downstream region at tRNA end position |
aaacacaagc |
Secondary structure (Cloverleaf model) | >WENV170726994 Lys CTT a ACCA aaacacaagc G - C G + T G - C C - G C - G C - G T - A C T T C A G C C A C G A A | | | | | G T C T C G G T C G G C G | | | | T T G G A G C T A A AGGTT A - T C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |