Sequence ID | >WENV170728608 |
Genome ID | LULE01055248 |
Search identical group | |
Phylum/Class | [LULE] marine metagenome; Red Sea water column Station 192 - depth 10m |
Species | |
Start position on genome | 411 |
End posion on genome | 336 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
gtttggaaaa |
tRNA gene sequence |
GACCTGGTAGCTCAGCCGGTAGAGCATCTCCCTTTTAAGGAGAGGATCCTGGGTTCGAAC |
Downstream region at tRNA end position |
atctagcgca |
Secondary structure (Cloverleaf model) | >WENV170728608 Lys TTT a ACTA atctagcgca G - C A - T C - G C - G T - A G - C G - C C A T G A C C C A C G A A | | | | | G C C T C G C T G G G C G | | | | T T G G A G C T A A GGATC T - A C - G T - A C - G C - G C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |