Sequence ID | >WENV170735964 |
Genome ID | LULL01026913 |
Search identical group | |
Phylum/Class | [LULL] marine metagenome; Red Sea water column Station 149 - depth 500m |
Species | |
Start position on genome | 508 |
End posion on genome | 435 |
Amino Acid | Cys |
Anticodon | GCA |
Upstream region at tRNA start position |
tatgggacga |
tRNA gene sequence |
GGCCCGATGGCGGAGTGGTTACGCAGAGGACTGCAAATCCTTGCACGCCGGTTCGATTCC |
Downstream region at tRNA end position |
taatttcccg |
Secondary structure (Cloverleaf model) | >WENV170735964 Cys GCA a TCCA taatttcccg G - C G - C C - G C - G C - G G - C A - T T T T C G G C C A G A G | | | | | G T G G C G G C C G G C G | | | T T G A C G C T T A GCAC G + T A - T G - C G - C A - T C A T A G C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |