Sequence ID | >WENV170736415 |
Genome ID | LULM01002731 |
Search identical group | |
Phylum/Class | [LULM] marine metagenome; Red Sea water column Station 149 - depth 200m |
Species | |
Start position on genome | 2104 |
End posion on genome | 2015 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
ggcgccgcaa |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTTAAGGCAGCGGTCTTGAAACCCCCCGTGGGTGCAAGCTCA |
Downstream region at tRNA end position |
tttgcccatg |
Secondary structure (Cloverleaf model) | >WENV170736415 Ser TGA a GCCA tttgcccatg G - C G - C A - T C - G A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGGGTGCAAGCTCACC G - C C C G - C G - C T C C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
Input this 5 letters | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |