Sequence ID | >WENV170740762 |
Genome ID | LULS01000033 |
Search identical group | |
Phylum/Class | [LULS] marine metagenome; Red Sea water column Station 108 - depth 200m |
Species | |
Start position on genome | 3098 |
End posion on genome | 3025 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tacaattgtG |
tRNA gene sequence |
GCCTTCGTAGTACAGTGGTTAGTATAGGGGATTGTGGATCCCCGGACAGGAGTTCGATTC |
Downstream region at tRNA end position |
taatcctaaa |
Secondary structure (Cloverleaf model) | >WENV170740762 His GTG G CTtc taatcctaaa G - C C - G C - G T + G T - A C - G G - C T T T T C C C C A T G A A | | | | G G C A T G A G G A G C G | | | + T T T G T A T T A A GGAC G - C G - C G - C G - C A - T T A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment | |
Comment | |
![]() | |
Attention: When your comment is judged as an irrelevant one by the administrator, your comment will be deleted by the administrator. |